INTRODUCTION:

Diabetes Mellitus is an endocrine disorder characterized by a loss of glucose homeostasis leading to derangements in the metabolism of protein and lipid metabolism, resulting from partial or complete deficiency in insulin synthesis/secretion and/or due to peripheral resistance to insulin action¹. In diabetes mellitus either due to the deficiency of insulin or resistant to the action of insulin, skeletal muscle cells are unable to utilize the glucose as a chief energy source. Skeletal muscle, a primary tissue responsible for post prandial uptake of glucose from blood, accounts for nearly 40% of body mass and >30% energy expenditure. Glucose transport is the rate-limiting step in glucose utilization in insulin targeted skeletal muscle. This transport is facilitated by the major glucose transporter proteins, GLUT4 and GLUT 1 in skeletal muscle². Thus, skeletal muscle is quantitatively the most important glucose-utilizing tissue and the acceleration of glucose uptake into skeletal muscle upon exposure to insulin is accompanied by a redistribution of the “insulin-responsive” facilitated glucose transporter isoform, GLUT4³.

The insulin signaling pathway leading to increased muscle glucose uptake involves the binding of insulin to its receptor, phosporylation of downstream insulin receptor substrates (IRS) and activation of phosphatidyl inositol 3 kinase (PI3-K) and Akt which promotes the membrane translocation of GLUT4 from the intracellular pools⁴. Defects in GLUT4 translocation contribute to insulin resistance, a characteristic of diabetes mellitus⁵.

Phosphatidyl inositol 3 kinase is a key molecular switch, which mediates the metabolic effects of insulin, glucose transport and GLUT4 translocation⁶. Studies exploring the role of phosphatidyl inositol 3 kinase in insulin signaling enumerate the upregulation of insulin dependant glucose transport and GLUT4 translocation in cultured L6 myotubes⁷. Impaired GLUT4 translocation and reduced expression of PI3 kinase and PPARγ have been studied in detail under diabetic condition. The use of oral hypoglycemic drugs in the treatment of diabetes often leads to undesirable side effects. Plant derived phytochemicals have been reported to exert beneficial effects in diseases such as cancer, diabetes, cardiovascular diseases and neurogenerative disorders.

Resveratrol is a naturally occurring polyphenolic phytoalexin produced in significant amounts as a secondary metabolite in grapes in response to fungal infections. Resveratrol has been reported to possess wide variety of pharmacological properties. The protective properties of resveratrol observed through in vitro and in vivo studies and the presence of high amount of resveratrol in red wine had led the scientific community to deem that resveratrol is the substance competent for the “French paradox”: the phenomenon that the frequent consumption of red wine in France is associated with a reduced mortality due to coronary heart disease and cancer as compared with other European countries⁸.

Resveratrol has been reported to elicit many cellular responses including cell cycle arrest, differentiation and apoptosis⁹ and has antiinflammatory, antileukemic and antiviral and neuroprotective properties^10-12. Resveratrol can also function as an antioxidant¹³ and reduces the risk of developing coronary heart disease, likely through its modulation of lipid metabolism and prevention of the low-density lipoprotein oxidation¹⁴, as well as inhibition of eicosanoid production and platelet aggregation¹⁵. In vivo resveratrol was shown to protect mice against high-fat diet induced insulin resistance^16,17. More recent studies conducted by us revealed the non-toxic, antidiabetic potentials and tissue protective nature of resveratrol in STZ-nicotinamide induced diabetic rats^18-22. However, the underlying mechanism(s) by which resveratrol elicits its antidiabetic activity is still to be investigated. In the light of the above, the present investigation was aimed to elucidate the mechanism of action of resveratrol at the cellular level. The effect of resveratrol on GLUT4 translocation and expression of PI3 kinase and PPARγ were analyzed in L6 skeletal muscle cells. L6 skeletal muscle cells, an insulin responsive cell line, is a well established in vitro skeletal muscle model to study the regulation of glucose transport²³, since skeletal muscle is the major site for primary glucose disposal and glucose utilization.

MATERIALS AND METHODS:

L6 myoblast cell line was obtained from National Centre for Cell Sciences (NCCS), Pune, India. 2-Deoxy-D-glucose, bovine serum albumin (BSA), α-MEM and other cell culture solutions were procured from Hi-media, India. The fetal bovine serum (FBS), penicillin, streptomycin, gentamycin, amphotericin B was purchased from Genetix, India. Enzymes like hexokinase, glucose-6-phosphate dehydrogenase (G6PDH), diaphorase, NADP⁺, ATP were purchased from SRL, Mumbai, India. Triethanolamine hydrochloride (TEA) was procured from Rankem, India. Resveratrol, resazurin, primers for RT-PCR and insulin were obtained from Sigma Aldrich, USA.

Cell culture of L6 myoblasts and myotubes:

L6 myoblasts were maintained in α-MEM with 10% FBS and supplemented with penicillin (120units ml^-1), streptomycin (75mg ml^-1), gentamycin (160mg ml^-1) and amphotericin B (3mg ml^-1) in 5% CO₂ environment. For differentiation of L6 cells they were transferred to α-MEM with 2% FBS, and again the cells were seeded in a collagen-coated 96 well (4x10³ cells/well) micro plate and cultured in α-MEM for 3 days with 10% FBS till semi confluents. Next, the cells were cultured in α-MEM with 2% FBS for 5 days to differentiate into myotubes which were then used for 2-deoxyglucose uptake assay. The extent of differentiation to myotubes was established by observing multinucleation of cells with the aid of inverted tissue culture microscope (Euromex, Finland).

2-Deoxyglucose uptake assay:

The differentiated L6 myotubes were incubated with 170 ml/well of a-MEM with 2% FBS in the presence of resveratrol at a concentrations of 10, 20, 50, 100, 150 mM for 4 hrs. After incubation, the cells are washed with twice with Krebs-Ringer-Phosphate-HEPES (KRPH) buffer (pH 7.4) containing 0.1% BSA. The washed myotubes are then incubated with KRPH buffer containing 1mM 2-Deoxy glucose and 0.1% BSA for 2 hrs (termed the 2-DG uptake period) at 37°C in 5% CO₂. After incubation, the cells are washed twice with KRPH buffer containing 0.1% BSA and then 25 μl of 0.1 N NaOH is added. To degrade NAD(P)H, NAD(P)⁺ and any enzymes in the cells, the culture plate is subjected to one freeze-thaw cycle and incubated at 85°C for 40 min on a temperature-controlled bath. The components in the wells are then neutralized by the addition of 25 μl of 0.1 N HCl and then 25 μl of 150 mM TEA buffer (pH 8.1) is added. Uptake of 2-DG into the cells is measured by the enzymatic fluorescence assay²⁴.

Reverse transcription - polymerase chain reaction:

RT-PCR is carried out as described previously by Hall et al²⁵. The differentiated L6 myotubes were incubated with 170 ml/well of a-MEM with 2% FBS in the presence of resveratrol at a concentrations of 10, 20, 50, 100, 150 mM for 4 hrs. After incubation, cells are lysed in TRIzol, proteins are extracted with chloroform and total RNA is precipitated with isopropanol. The RNA precipitate is washed with 70% ethanol and resuspended in 50μl of DEPC-treated water. The primers used are as follows.

GLUT4:

Sense 5'-CGG GAC GTC GAG CTG GCC GAG GAG-3'

Antisense 5'-CCC CCT CAG CAG CGA GTG A-3'

PPARγ:

Sense 5'-GGA TTC ATG ACC AGG GAG TTC CTC-3'

Antisense 5'-GCG GTC TCC ACT GAG AAT GAC-3'

PI3 Kinase:

Sense 5'-TGA CGC TTT CAA ACG CTA TC-3'

Antisense 5'-CAG AGA GTA CTC TTG CAT TC-3'

GAPDH (House keeping gene):

Sense 5'- TGCCACTCAGAAGACTGTGG -3'

Antisense 3'- TTCAGCTCTGGGATGACCTT -5'

For PCR reaction, 1 ml of cDNA prepared was added to a PCR reaction mix consisting of 10 X PCR buffer, 2mM dNTP, 10pM of paired primers, 2 units of Taq polymerase and distilled water in a total volume of 50ml. The reaction mixture was overlaid with mineral oil and placed in a PCR thermal cycler for 35 cyclic reactions. PCR products were run on 1.5% agarose gels, stained with ethidium bromide and photographed.

Statistical analysis:

The results were expressed as mean ± S.E.M and statistical significance was evaluated by one-way analysis of variance (ANOVA) using SPSS (version 11.5) program followed by LSD. Values were considered statistically significant when p < 0.05.

RESULTS:

Effect of resveratrol on 2-deoxy glucose uptake by rat L6 muscle cells:

Fig.1 depicts the effect of resveratrol on 2-deoxy glucose uptake by rat L6 muscle cells. There was no significant 2-deoxy glucose uptake at a concentration of 10, 20 mM, while a significant glucose uptake was observed at a concentration of 50 mM but a maximum response at 150mM and 200 mM. There was no significant difference in the uptake of glucose by resveratrol at 150mM and 200 mM. So, the minimal dose 150 mM of resveratrol elicits maximum response and it was fixed for evaluating the effect of resveratrol on the expression of molecular biomarkers.

Effect of resveratrol on the expressions of GLUT-4, PI3 kinase and PPARγ at the transcript level:

The mechanistic action of glucose uptake mediated by resveratrol treated myotubes was analyzed for the expressions of GLUT 4, PI3 kinase and PPARγ at transcript level by semi-quantitative RT-PCR technique. The relative densitometry scanning (Fig. 2) revealed an increase in GLUT-4 transcript by ~1.8 fold by resveratrol over control cells comparable to insulin (~2.6 fold) exemplifies the role of resveratrol in glucose transport.

Fig 3 The densitometric scanning showed ~1.7 fold increased PI3 kinase expression by resveratrol comparable with insulin (~2.4 fold) over untreated control cells. The densitometric scanning (Fig 4) showed ~1.2 fold increased PPARγ expression by resveratrol comparable with insulin (~1.8 fold) over untreated control cells.

DISCUSSION:

Diabetes mellitus is a multisystemic endocrine disease characterized by defective utilization of blood glucose due to impaired glucose transport or reduced GLUT4 translocation. PPAR γ and PI3 kinase play a crucial role in glucose transportation inside the cells. PI3 kinase is the key molecular switch in the insulin signaling cascade and its complete down regulation abolishes glucose uptake. The insulin stimulated acute activation of glucose transport mainly occurs by one of two mechanisms: translocation of GLUT4 and GLUT1 from intracellular vesicles to the plasma membrane and augmentation of the intrinsic catalytic activities of the transporters^26,27. STZ induced diabetic rat model shows marked insulin resistance that affects glucose transport both in adipose tissue and skeletal muscle²⁸. Among the in vitro models, L6²⁹ and C2C12³⁰ muscle cell lines are commonly used to test for effects of glucose uptake, glucose metabolism and glycogen synthesis since the muscle is the major site which utilizes and disposes glucoses. Cline et al. have reported that glucose transport is the rate-controlling step in skeletal-muscle glucose metabolism in both normal subjects and those with type 2 diabetes wherein resistance to the stimulatory effect of insulin on glucose transport and/ or utilization is a key pathogenic feature³¹. The maximum glucose uptake was achieved at a concentration of 150μM by resveratrol suggesting that resveratrol may have a significant role in glucose uptake.

GLUT 4 is the main insulin responsive glucose transporter and is located primarily in muscle cells and adipocytes. GLUT 4 differs from other glucose transporters in that about 90 percent of it is sequestered intracellularly in the absence of insulin or other stimuli such as exercise. In the presence of insulin or another stimulus, the regulated movement of GLUT 4 from intracellular storage vesicles to the plasma membrane is favored and the net effect is a rise in the maximal velocity of glucose transport into the cells³². Thus, in normal muscle cells and adipocytes, GLUT 4 is recycled between the plasma membrane and the intracellular storage pools^4,33 . Earlier reports on L6 myotubes³⁴ the maximum glucose uptake activity by troglitazone and rosiglitazone was due to increased GLUT4 expression. Prabahakar and Doble have reported that there is upregulation in the expressions of GLUT4, PI3K and PPARγ in the presence of phytochemicals in L6 myotubes³⁵. Increased expressions of these molecular biomarkers observed in the present study are concomitant with the above earlier findings.

Peroxisome proliferator activated receptor (PPARs) are ligand-dependent transcription factors that belong to the nuclear hormone receptor family³⁶. PPARs are the key regulators of lipid homeostasis and insulin resistance. They are expressed in a wide range of tissues, where they have diverse roles regulating lipid homeostasis, cellular differentiation, proliferation and the immune response. PPARs subfamily has been defined as PPARα, PPARβ (also called nuclear hormone receptor 1 (NUC-1) or fatty acid activated receptor (FAAR) and PPARγ. Each isoform was found to be encoded by a different gene and differ in their tissue distribution and ligand specificity³⁷. PPARα is predominantly expressed in tissues exhibiting high catabolic rate of fatty acids (liver, kidney, and heart), whereas PPARβ expression is ubiquitous, and its physiological role is unclear. PPARγ is expressed predominantly in adipose tissue, skeletal muscle, adrenal gland, spleen, large colon and the immune system³⁸. PPARα plays an important role in regulating adipocytes differentiation and glucose homeostasis³⁹. PPARγ agonists, a new class of insulin sensitizers are currently studied by pharmaceutical industries with a view toward finding activators that improve insulin sensitivity and lipid control⁴⁰. In the present study, the level of PPARγ is found to be elevated by resveratrol. This increase in PPARγ along with enhanced GLUT4 transcription suggested the promising role of PPARγ in the induction of glucose uptake in L6 myotubes by resveratrol. Activation of PPARγ through PPARγ agonists are known to increase the glucose uptake through induction of GLUT 4 mRNA⁴¹.

Phosphoinositide kinases (PIKs) are the group of enzymes that phosphorylate phosphatidylinositol and its derivatives. Studies of these purified enzymes led to the categorization PIKs into three general families: phosphoinositide-3-kinases (PI3Ks), ptdIns-4-kinases and phophoinositide-P kinases (PIP5Ks).

Insulin and growth factors (IGF-1) promote a 20 to 50 fold activation of PI3Ks which leads to the generation of 3-phosphorylated phosphoinositides which are believed to act as second messengers⁴²and protein-kinase B was found to be the physiological target for these second messengers⁴³. A proposed mechanism for the PI3Ks-dependent activation of PKB involves translocation of PKB from the cytosol to the plasma membrane and subsequent phosphorylation by one or several membrane associated kinases⁴⁴. The classical pathway of insulin mediated glucose transport involves the activation of PI3 kinase. Earlier studies indicated that L6 myotubes evidenced the active participation of PI3 kinase in insulin mediated glucose transport⁴⁵. PI3 kinase is down stream signaling molecule in the insulin signaling cascade which enhances the glucose uptake by the cell via GLUT 4 translocation⁴⁶. Since the role of PKB in insulin signalling is unquestioned and its decreased activity has been considered as a reliable parameter in type 2 DM, it also provides an opportunity as an attractive tool.

The results of the present study showed that resveratrol increases glucose uptake by PI3 mediated GLUT4 translocation which is evidenced from elevated PI3 kinase mRNA levels. In conclusion, resveratrol has potent effects to increase the glucose uptake by upregulating the battery of targets like GLUT 4, PI3 kinase and PPARγ in myotubes. These findings suggest that resveratrol has complimentary potency to develop as an antihyperglycemic agent for the treatment of diabetes mellitus.

ACKNOWLEDGEMENT:

The financial assistance from University Grants Commission (UGC), New Delhi, India is gratefully acknowledged.

REFERENCES:

1. American Diabetes Association. Diagnosis and classification of diabetes mellitus, Diabetes Care. 30;2007 :S42–S47.

2. Ziel FH, Venkatesan N and Davidson MB. Glucose transport is rate limiting for skeletal muscle glucose metabolism in normal and STZ-induced diabetic rats. Diabetes. 37; 1988: 885-890.

3. Barnard RJ and Youngren JF. Regulation of glucose transport in skeletal muscle. FASEB J. 6;1992:3238-3244.

4. Taniguchi CM, Emanuelli B and Kahn CR. Critical nodes in signalling pathways: insights into insulin action. Nature Reviews Molecular Cell Biology. 7;2006:85-96.

5. Shepherd PR and Kahn BB. Glucose transporters and insulin action--implications for insulin resistance and diabetes mellitus. The New England Journal of Medicine. 341; 1999: 248-257.

6. Okada T, Kawano Y, Sakakibara T, Hazeki O and Ui M. Essential role of phosphatidylinositol 3-kinase in insulin-induced glucose transport and antilipolysis in rat adipocytes. Studies with a selective inhibitor wortmannin, Journal of Biological Chemistry. 269; 1994: 3568-3573.

7. Ciaraldi TP, Huber-Knudsen K, Hickman M, and Olefsky JM. Regulation of glucose transport in cultured muscle cells by novel hypoglycemic agents. Metabolism. 44; 1995: 976-981.

8. Renaud S and de Lorgeril M. Wine, alcohol, platelets, and the French paradox for coronary heart disease. Lancet. 339; 1992: 1523-1526.

9. Joe AK, Liu H, Suzui M, Vural ME, Xiao D and Weinstein IB. Resveratrol induces growth inhibition, S-phase arrest, apoptosis, and changes in biomarker expression in several human cancer cell lines. Clinical Cancer Research. 8; 2002: 893-903.

10. Bhat KPL, Kosmeder JW 2^nd and Pezzuto JM. Biological effects of resveratrol. Antioxidants and Redox Signaling 3; 2001: 1041-1064.

11. Virgili M and Contestabile A. Partial neuroprotection of in vivo excitotoxic brain damage by chronic administration of the red wine antioxidant agent, trans-resveratrol in rats. Neuroscience Letters. 281; 2000: 123-126.

12. Gao X, Xu YX, Divine G, Janakiraman N, Chapman RA and Gautam SC. Disparate in vitro and in vivo antileukemic effects of resveratrol, a natural polyphenolic compound found in grapes. Journal of Nutrition. 132; 2002: 2076-2081.

13. Das DK, Sato M, Ray PS, Maulik G, Engelman RM, Bertelli AA and Bertelli A. Cardioprotection of red wine: role of polyphenolic antioxidants. Drugs under experimental and clinical research.. 25; 1999: 115-120.

14. Frankel EN, Waterhouse AL and Kinsella JE. Inhibition of human LDL oxidation by resveratrol. Lancet. 341; 1993: 1103-1104.

15. Pace-Asciak CR, Hahn S, Diamandis EP, Soleas G and Goldberg DM. The red wine phenolics trans-resveratrol and quercetin block human platelet aggregation and eicosanoid synthesis: implications for protection against coronary heart disease. Clinica Chimica Acta. 235; 1995: 207-219.

16. Baur JA, Pearson KJ, Price NL, Jamieson HA, Lerin C, Kalra A, Prabhu VV, Allard JS, Lopez-Lluch G, Lewis K, Pistell PJ, Poosala S, Becker KG, Boss O, Gwinn D, Wang M, Ramaswamy S, Fishbein KW, Spencer RG, Lakatta EG, Le Couteur D, Shaw RJ, Navas P, Puigserver P, Ingram DK, de Cabo R and Sinclair DA. Resveratrol improves health and survival of mice on a high-calorie diet. Nature. 444; 2006: 337-342.

17. Lagouge M, Argmann C, Gerhart-Hines Z, Meziane H, Lerin C, Daussin F, Messadeq N, Milne J, Lambert P, Elliott P, Geny B, Laakso M, Puigserver P and Auwerx J. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1alpha. Cell. 127; 2006: 1109-1122.

18. Palsamy P and Subramanian S. Resveratrol, a natural phytoalexin, normalizes hyperglycemia in streptozotocin-nicotinamide induced experimental diabetic rats. Biomedicine and Pharmacotherapy. 62 ; 2008: 598-605.

19. Palsamy P and Subramanian S. Modulatory effects of resveratrol on attenuating the key enzymes activities of carbohydrate metabolism in streptozotocin-nicotinamide induced diabetic rats. Chemico Biological Interactions. 179; 2009: 356-362.

20. Palsamy P, Sivakumar S and Subramanian S. Resveratrol attenuates hyperglycemia-mediated oxidative stress, proinflammatory cytokines and protects hepatocytes ultrastructure in streptozotocin-nicotinamide-induced experimental diabetic rats. Chemico Biological Interactions. 186; 2010: 200-210.

21. Palsamy P and Subramanian S. Ameliorative potential of resveratrol on proinflammatory cytokines, hyperglycemia mediated oxidative stress, and pancreatic beta-cell dysfunction in streptozotocin-nicotinamide-induced diabetic rats. Journal of Cellular Physiology. 224; 2010: 423-432.

22. Palsamy P and Subramanian S. Resveratrol protects diabetic kidney by attenuating hyperglycemia-mediated oxidative stress and renal inflammatory cytokines via Nrf2-Keap1 signaling. Biochimica et Biophysica Acta. 1812(7);2011: 719-731.

23. Koivisto UM, Martinez-Valdez H, Bilan PJ, Burdett E, Ramlal T and Klip A. Differential regulation of the GLUT-1 and GLUT-4 glucose transport systems by glucose and insulin in L6 muscle cells in culture. Journal of Biological Chemistry. 266; 1991: 2615-2621.

24. Yamamoto N, Sato T, Kawasaki K, Murosaki S and Yamamoto Y. A nonradioisotope, enzymatic assay for 2-deoxyglucose uptake in L6 skeletal muscle cells cultured in a 96-well microplate. Analytical Biochemistry. 351; 2006: 139-145.

25. Hall LR, Mehlotra RK, Higgins AW, Haxhiu MA and Pearlman E. An essential role for interleukin-5 and eosinophils in helminth-induced airway hyperresponsiveness. Infection and Immunity. 66; 1998: 4425-4430.

26. Mitsumoto Y, Burdett E, Grant A and Klip A. Differential expression of the GLUT1 and GLUT4 glucose transporters during differentiation of L6 muscle cells. Biochemical and Biophysical Research Communication. 175; 1991: 652-659.

27. Mitsumoto Y and Klip A. Development regulation of the subcellular distribution and glycosylation of GLUT1 and GLUT4 glucose transporters during myogenesis of L6 muscle cells. Journal of Biological Chemistry. 267; 1992: 4957-4962.

28. Karnieli E, Hissin PJ, Simpson IA, Salans LB and Cushman SW. A possible mechanism of insulin resistance in the rat adipose cell in streptozotocin-induced diabetes mellitus. Depletion of intracellular glucose transport systems. Journal of Clinical Investigation. 68; 1981: 811-814.

29. Sarges R, Hank RF, Blake JF, Bordner J, Bussolotti DL, Hargrove DM, Treadway JL and Gibbs EM. Glucose transport-enhancing and hypoglycemic activity of 2-methyl-2-phenoxy-3-phenylpropanoic acids. Journal of Medicinal Chemistry 39; 1996: 4783-4803.

30. Lazarus DD, Trimble LA and Moldawer LL. The metabolic effects of pokeweed mitogen in mice. Metabolism. 47; 1998: 75-82.

31. Cline GW, Petersen KF, Krssak M, Shen J, Hundal RS, Trajanoski Z, Inzucchi S, Dresner A, Rothman DL and Shulman GI. Impaired glucose transport as a cause of decreased insulin-stimulated muscle glycogen synthesis in type 2 diabetes. The New England Journal of Medicine. 341; 1999: 240-246.

32. Gould GW and Holman GD. The glucose transporter family: structure, function and tissue-specific expression. Biochemical Journal. 295; 1993: 329-341.

33. Dugani CB, Randhawa VK, Cheng AW, Patel N and Klip A. Selective regulation of the perinuclear distribution of glucose transporter 4 (GLUT4) by insulin signals in muscle cells. European Journal of Cell Biology. 87; 2008: 337-351.

34. Yonemitsu S, Nishimura H, Shintani M, Inoue R, Yamamoto Y, Masuzaki H, Ogawa Y, Hosoda K, Inoue G, Hayashi T and Nakao K. Troglitazone induces GLUT4 translocation in L6 myotubes. Diabetes. 50; 2001: 1093-1101.

35. Prabhakar PK and Doble M. Interaction of phytochemicals with hypoglycemic drugs on glucose uptake in L6 myotubes. Phytomedicine 18; 2011: 285-291.

36. Issemann I and Green S. Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature. 347; 1990: 645-650.

37. Forman BM, Chen J and Evans RM. The peroxisome proliferator-activated receptors: ligands and activators. Annals of the New York Academy of Sciences. 804; 1996: 266-275.

38. Fajas L, Auboeuf D, Raspe E, Schoonjans K, Lefebvre AM, Saladin R, Najib J, Laville M, Fruchart JC, Deeb S, Vidal-Puig A, Flier J, Briggs MR, Staels B, Vidal H and Auwerx J. The organization, promoter analysis, and expression of the human PPARgamma gene. Journal of Biological Chemistry. 272; 1997: 18779-18789.

39. Spiegelman BM. PPAR-gamma: adipogenic regulator and thiazolidinedione receptor. Diabetes. 47; 1998: 507-514.

40. Sharma S, Sowjanya A, Kumari M, Suryaprakash R, Cynthia G, Suresh J and Chakrabarti R. Biochemical mechanism of insulin sensitization, lipid modulation and anti-atherogenic potential of PPAR alpha/gamma dual agonist: Ragaglitazar. Life Sciences. 80; 2006: 235-244.

41. Shimaya A, Kurosaki E, Shioduka K, Nakano R, Shibasaki M and Shikama H. YM268 increases the glucose uptake, cell differentiation, and mRNA expression of glucose transporter in 3T3-L1 adipocytes. Hormone and Metabolic Research. 30; 1998: 543-548.

42. Carpenter CL and Cantley LC. Phosphoinositide kinases. Current Opinion in Cell Biology. 8; 1996: 153-158.

43. Datta K, Bellacosa A, Chan TO and Tsichlis PN. Akt is a direct target of the phosphatidylinositol 3-kinase. Activation by growth factors, v-src and v-Ha-ras, in Sf9 and mammalian cells. Journal of Biological Chemistry. 271; 1996: 30835-30839.

44. Kohn AD, Takeuchi F and Roth RA. Akt, a pleckstrin homology domain containing kinase, is activated primarily by phosphorylation. Journal of Biological Chemistry. 271; 1996: 21920-21926.

45. Bandyopadhyay G, Standaert ML, Galloway L, Moscat J and Farese RV. Evidence for involvement of protein kinase C (PKC)-zeta and noninvolvement of diacylglycerol-sensitive PKCs in insulin-stimulated glucose transport in L6 myotubes. Endocrinology. 138; 1997: 4721-4731.

46. Prabhakar PK and Doble M. Synergistic effect of phytochemicals in combination with hypoglycemic drugs on glucose uptake in myotubes. Phytomedicine. 16; 2009: 1119-1126.

Received on 10.06.2011 Modified on 28.06.2011

Asian J. Research Chem. 4(8): August, 2011; Page 1318-1323

Figure 4. Semiquantification analysis of PPARγ transcripts by scanning densitometry